Name: Hordeum vulgare ULTRAVIOLET RESISTANCE D (HvUvrD)

NCBI Database ScholarGoogle eFP browser eFP browser NCBI NCBI

Function: Nucleotide Excision Repair

coding sequence:

Mutations: In progress...

Length: 3950 bp

NCBI: HM190158.1

Arabidopsis homolog: show

ESTs used: AK249062

all ESTs: show

primers used: 1F: 5` GCGCTGGAAGGAAAACATT 3`
1R: 5` GTGGCATAGTGCTCCTGGTT 3`
2F: 5` AGGAGCACCATGCCATATCT 3`
2R: 5` GGAATTTTTAATGTCTCCATCACA 3`
3F: 5` AGCATGGCAAAAGTGATGGT 3`
3R: 5` TTTGCCAGTTATCTGTCTTCGAT 3`
4F: 5` AGGTCGCGACTTTGGTAAAA 3`
4R: 5` CCTCCTTCCGGGATCTAAAA 3`
5F: 5` GAAAGGCTGCACTGCTACACT 3`
5R: 5` TTGCGCTTGTACCCTTTACC 3`
6F: 5` TCATCATTGGGCGAAGAAG 3`
6R: 5` ATAAGATTGGACGCGTGGAG 3`

Protein:

Length: 1185 aa

NCBI: 300245038

Alignment: barley/rice/Arabidopsis proteins

Secondary structure: barley
rice
Arabidopsis