Name: Hordeum vulgare MUTL-HOMOLOGUE1 (HvMLH1)

NCBI Database ScholarGoogle eFP browser eFP browser NCBI NCBI

Function: Mismatch repair

coding sequence:

Mutations: In progress...

Length: 2332 bp

NCBI: HM535227.1

Arabidopsis homolog: show

ESTs used: BF616812, BU984605, BQ469866, BQ469866, BQ664846

all ESTs: show

primers used: 1F: 5` GTCTTCGCCTCCCCATTC 3`
1R: 5` GTCGGAGACCTGGATGAGC 3`
2F: 5` CGTCGAGAACAGCATCGAC 3`
2R: 5` ACGGTAACATGGCCAACATAA 3`
3F: 5` CATCCGGTGTGAGGACTTG 3`
3R: 5` TGAGATGAAACCATCCATCTTG 3`
4F: 5` CGGTTGTTCGTGATCTGATG 3`
4R: 5` CGAAAAGGCCAGGATGTAAG 3`
5F: 5` TGGCAAGGTCAAACTTCAAA 3`
5R: 5` AGGAAGTCTGGTCAGGTTGC 3`
6F: 5` TTGCAGAAGCGAACACTGAG 3`
6R: 5` GCAGCTCTTGATCGATGTCA 3`
7F: 5` ATCCTCCCATCCTTCCAAAT 3`
7R: 5` GCTTGTCGGCTAGCATCTCT 3`

Protein:

Length: 728 aa

NCBI: 301153985

Alignment: barley/rice/Arabidopsis proteins

Secondary structure: barley
rice
Arabidopsis